U.S. flag

An official website of the United States government

Format

Send to:

Choose Destination

SRX1850086: TLR1 coding exon of Sciurus vulgaris: specimen Brw15-22
1 ILLUMINA (Illumina MiSeq) run: 318,397 spots, 191.7M bases, 136.1Mb downloads

Design: We designed primers flanking the TLR1 coding exon (F: GGAAACCACCCTTTGTCTCA, R: AAAGGGTGAACTGAGGACTGAA) and amplified 2.7 kb-long amplicons. Fragmentation of the PCR product was performed by an enzymatic procedure. Briefly, 32 ?l of amplicons were mixed with 4 ?l of 10X Fragmentase Reaction Buffer v2 (New England Biolabs, USA, MA) and 4 ?l of ds Fragmentase. The mix was incubated 5 min at 37°C and the reaction stopped with 10 ?l of EDTA 0.5M. The reaction was purified using AMPure XP beads (Beckman Coulter USA, IN) with a 1.8X volume. Sequencing libraries were synthesized with the Kapa Hyper prep kit (Kapa Biosystems, Wilmington, MA, USA), according to the manufacturer’s instructions. PentAdaptersTM (PentaBase, APS, Denmark) were used to barcode the library and were diluted according to Kapa’s recommendation and the starting DNA concentration. After the final amplification step, libraries were quantified using Qubit dsDNA BR Assay Kit (Thermo Fisher Sc., USA, MA) and the fragment size was assessed by Fragment Analyzer (Advanced Analytical Technologies, Inc. Ankeny, USA).
Submitted by: Ecole Polytechnique Federale de Lausanne
Study: TLR1 variation linked with leprosy in Sciurus vulgaris from the British Isles
show Abstracthide Abstract
Mutations in TLR1 have been found to be associated with leprosy in humans and armadillos. In this study we sequenced the TLR1 coding sequence of red squirrels from the British Isles. We compared red squirrels infected with leprosy-causing bacteria (Mycobacterium leprae or Mycobacterium lepromatosis) with PCR-negative squirrels.
Sample: Sciurus vulgaris specimen Brw15-22 infected with Mycobacterium leprae
SAMN05255309 • SRS1507937 • All experiments • All runs
Library:
Name: Brw15-22_TLR1
Instrument: Illumina MiSeq
Strategy: AMPLICON
Source: GENOMIC
Selection: PCR
Layout: PAIRED
Runs: 1 run, 318,397 spots, 191.7M bases, 136.1Mb
Run# of Spots# of BasesSizePublished
SRR3674450318,397191.7M136.1Mb2016-09-30

ID:
2643848

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...